A simple example of sequence-level thermodynamic analysis, structural stress mapping, and compliance scoring.
This demo walks through a single construct analyzed by Φ-Mapping. It shows how a raw DNA sequence becomes a set of thermodynamic metrics, a Torsion Index Map, and an overall compliance score that predicts synthesis stability and operational reliability.
Φ-Mapping accepts standard formats such as FASTA, GenBank, and SBOL, as well as raw sequence strings. Here is a simplified FASTA example.
>construct_ABC_v3
ATGACCATGATTACGCCAAGCTTGCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGCGGCCGCACTAGT
GCTAGCGGCCGCTGCAGGTCGACGGTACCGAGCTCGAATTCCTGCAGGCATGCAAGCTTGAATTCGCGGCCGCTGCAG
In a real integration, sequences are submitted programmatically through the API or automatically from design tools and LIMS systems.
The sequence above produces the following result structure. Values are representative, illustrating how symbolic entropy, structural stress metrics, and compliance scores are reported.
{
"sequence_id": "construct_ABC_v3",
"length": 842,
"metrics": {
"symbolic_entropy": 0.41,
"compliance_score": 0.79,
"classification": "marginal",
"torsion_index_max": 2.4,
"torsion_hotspot_count": 3
},
"torsion_index_map": [
{"position": 120, "index": 2.1},
{"position": 421, "index": 2.4},
{"position": 685, "index": 2.2}
],
"hotspots": [
{"position": 421, "severity": 0.82, "type": "GC_cluster"},
{"position": 685, "severity": 0.76, "type": "repeat_structure"},
{"position": 712, "severity": 0.69, "type": "secondary_structure"}
],
"recommendation": "Sequence is marginal. Consider optimizing regions around positions 421 and 685 to improve stability before synthesis."
}The key outputs are the symbolic entropy score, the compliance score, and the Torsion Index Map. Together, they form a structural stress map at sequence level, identifying where the construct is most likely to experience thermodynamic instability.
The compliance score of 0.79 places this construct in the marginal range. It is likely to synthesize, but with elevated risk compared to a stable sequence. The Torsion Index Map reveals three structural stress hotspots, with the most severe at position 421. Targeted redesign of these regions can often convert a marginal construct into a stable one without changing the rest of the sequence.
Teams often use automated rules based on these metrics. For example, constructs with compliance scores above 0.8 may be accepted automatically, those between 0.6 and 0.8 may require manual review, and those below 0.6 may be flagged for redesign before any synthesis orders are placed.
In practice, hundreds or thousands of sequences are processed at once. Φ-Mapping is typically integrated as a validation step between design and synthesis. Design tools export sequences, Φ-Mapping computes sequence-level thermodynamic metrics and structural stress maps, and only sequences that meet stability requirements continue to fabrication.
This reduces synthesis failures, shortens troubleshooting cycles, and gives both designers and synthesis providers a shared, quantitative language for discussing thermodynamic risk.
A full demonstration can use your own sequence data or benchmark datasets and can include retrospective and prospective validation analysis. Sessions can be tailored for DNA foundries, bio-computing labs, or governance teams.